3 d

With a 95% probability,?

It is of course listed in his wiki bio that his male ancestor that migrated?

She likely lived in the Middle East, perhaps in the area of Iran. Thumbs Up: Received: 15,591 Given: 8,909 In India and Pakistan, R1a ranges from 15 to 50% of the population, depending on the region, ethnic group and caste. Some descendant subclades have been found since pre-history in Europe, Central Asia and South Asia. R-YP270* R-CTS4648 YP1407 * CTS654 * FT62527(H) +6 SNPs formed 3100 ybp, TMRCA 2700 ybp info. autotrader honda odyssey I attached her 23andme, her Eurogenes K15, and JTest, it has some Ashkenazi matches. The only 12-marker matches with zero steps are a handful of Louisianians who share my surname. Trusted by business builders worldwide, the HubS. Kit number: A061901 Kit A061901 Admix Results (sorted): # Population Percent 1 North_Atlantic 28. [YP270] hg38 Position: ChrY:1357873913578739 Ancestral: A Derived: C Reference: Vladimir Tagankin (2014) ISOGG Haplogroup: R1a1a1b1a2a2 Comments: Downstream R1a-Z92 Forward Primer: YP270_F TGGGTATGTGAAAGGCTACAG Reverse Primer: YP270_R CCAAAATCTACAGGGCAAGC Add to Cart Reviews Customers who bought this product also purchased R-S3375 FT88584 * FT226428 * FT226693 +15 SNPs formed 1950 ybp, TMRCA 225 ybp info id:YF073760 id:HG00382 FIN R-Y86535 Y86289 * Y86535 * Y318357 +7 SNPs formed 1950 ybp, TMRCA 1200 ybp info id:YF100339 id:YF008051 LTU [LT-VL] pol Haplogroup YTree v1200 (28 April 2024) Details of age estimation algorithm described in FAQ → My Y-DNA results. so I am an elf then. citibank sg The Avars reside in a region known as the North Caucasus, the northern section of a larger area between the Black and Caspian Seas. Alevi Kurd Y-DNA: G2a mtDNA: C4b Eurogenes K13 Oracle results: Kit M153951 Admix Results (sorted): Mar 4, 2019 · Apricity is a European Cultural Community R1a-YP270 Religion Orthodox Gender Posts 24,150. They’re cheaper, super durable, and there’s a lot of freedom to customize. R1a mtDNA H1 Hero Superfluous Gender Posts 18,071. 5343 pill Apulians and Calabrians results show an elevated % of greek and balkan with a lot of these showing recent ancestors, that's mean there was a recent migration from mainland or. ….

Post Opinion